fastp — Fast FASTQ Quality Control and Adapter Trimming
Overview
fastp performs adapter trimming, quality filtering, and QC reporting for Illumina FASTQ files in a single multi-threaded pass. It automatically detects adapter sequences from paired-end read overlaps — eliminating the need to specify adapters manually. fastp corrects mismatches in paired-end overlap regions, filters reads by quality score and length, removes polyX tails (polyA for RNA-seq), and generates interactive HTML and machine-readable JSON QC reports. Being 3–10× faster than Trim Galore and Trimmomatic while providing comparable or better results, fastp has become the standard preprocessing step before alignment in WGS, RNA-seq, and ChIP-seq pipelines.
When to Use
- Trimming Illumina adapters and low-quality bases before alignment in any NGS pipeline (RNA-seq, WGS, WES, ChIP-seq, ATAC-seq)
- Generating per-sample QC reports (HTML + JSON) as the first step of a pipeline, before MultiQC aggregation
- Processing paired-end reads where adapter auto-detection from overlap is preferred over manual adapter specification
- Removing polyA tails from RNA-seq reads from 3′ end-enriched protocols (Smart-seq, QuantSeq)
- Splitting a FASTQ file by UMI or by index for demultiplexing workflows
- Use Trim Galore as an alternative when TrimGalore's detailed per-base quality report from FastQC is required alongside trimming
- Use Trimmomatic as an alternative for fine-grained control of sliding-window trimming steps
Prerequisites
- Software: fastp (conda or pre-compiled binary)
- Input: raw Illumina FASTQ files (single-end or paired-end, .fastq or .fastq.gz)
Check before installing: The tool may already be available in the current environment (e.g., inside a
pixi/condaenv). Runcommand -v fastpfirst and skip the install commands below if it returns a path. When running inside a pixi project, invoke the tool viapixi run fastprather than barefastp.
# Install with conda
conda install -c bioconda fastp
# Or download pre-compiled binary (Linux)
wget https://github.com/OpenGene/fastp/releases/download/v0.24.0/fastp
chmod +x fastp
./fastp --version
# fastp 0.24.0
# Verify
fastp --version
Quick Start
# Paired-end adapter trimming with QC report
fastp \
-i sample_R1.fastq.gz \
-I sample_R2.fastq.gz \
-o sample_R1.trimmed.fastq.gz \
-O sample_R2.trimmed.fastq.gz \
-h sample_qc.html \
-j sample_qc.json \
--thread 8
echo "Trimmed reads in: sample_R1.trimmed.fastq.gz"
Workflow
Step 1: Single-End Adapter Trimming
Run fastp on single-end FASTQ with automatic adapter detection.
# Single-end with auto adapter detection
fastp \
-i sample.fastq.gz \
-o sample.trimmed.fastq.gz \
-h sample_qc.html \
-j sample_qc.json \
--thread 8 \
--qualified_quality_phred 20 \
--length_required 36
echo "Input reads: $(zcat sample.fastq.gz | wc -l | awk '{print $1/4}')"
echo "Output reads: $(zcat sample.trimmed.fastq.gz | wc -l | awk '{print $1/4}')"
Step 2: Paired-End Adapter Trimming
Process paired-end FASTQ files with overlap-based adapter detection and correction.
# Paired-end with overlap-based adapter auto-detection
fastp \
-i sample_R1.fastq.gz \
-I sample_R2.fastq.gz \
-o sample_R1.trimmed.fastq.gz \
-O sample_R2.trimmed.fastq.gz \
-h sample_qc.html \
-j sample_qc.json \
--thread 8 \
--correction \
--detect_adapter_for_pe \
--qualified_quality_phred 20 \
--length_required 36
# Specify adapters explicitly (if auto-detection fails)
# fastp -i R1.fq.gz -I R2.fq.gz \
# --adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
# --adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
# -o R1.out.fq.gz -O R2.out.fq.gz
Step 3: Quality Filtering and Read Length Trimming
Configure quality and length thresholds for stricter or more lenient filtering.
# Strict quality filtering (e.g., for variant calling)
fastp \
-i sample_R1.fastq.gz \
-I sample_R2.fastq.gz \
-o sample_R1.filtered.fastq.gz \
-O sample_R2.filtered.fastq.gz \
-h sample_qc.html \
-j sample_qc.json \
--thread 8 \
--qualified_quality_phred 25 \
--unqualified_percent_limit 20 \
--length_required 50 \
--max_len1 150 \
--max_len2 150 \
--low_complexity_filter \
--complexity_threshold 30
echo "Filtering complete. Check sample_qc.html for pass/fail rates."
Step 4: RNA-seq polyA Tail Removal
Remove polyA tails from 3′-enriched RNA-seq protocols before alignment.
# Remove polyA tails (QuantSeq 3′ mRNA-seq)
fastp \
-i quantseq_R1.fastq.gz \
-o quantseq_R1.trimmed.fastq.gz \
-h quantseq_qc.html \
-j quantseq_qc.json \
--thread 8 \
--trim_poly_x \
--poly_x_min_len 10 \
--qualified_quality_phred 20 \
--length_required 25
# For Smart-seq2 paired-end with polyA
fastp \
-i smartseq_R1.fastq.gz \
-I smartseq_R2.fastq.gz \
-o smartseq_R1.trimmed.fastq.gz \
-O smartseq_R2.trimmed.fastq.gz \
--trim_poly_x --poly_x_min_len 10 \
--thread 8 \
-h smartseq_qc.html -j smartseq_qc.json
Step 5: Parse QC Report JSON for Pipeline Monitoring
Extract key QC metrics from fastp's JSON output for automated quality gates.
import json
from pathlib import Path
def parse_fastp_json(json_path: str) -> dict:
with open(json_path) as f:
data = json.load(f)
before = data["summary"]["before_filtering"]
after = data["summary"]["after_filtering"]
return {
"total_reads_in": before["total_reads"],
"total_reads_out": after["total_reads"],
"pct_passed": after["total_reads"] / before["total_reads"] * 100,
"q30_rate_before": before["q30_rate"] * 100,
"q30_rate_after": after["q30_rate"] * 100,
"mean_len_before": before["read1_mean_length"],
"mean_len_after": after["read1_mean_length"],
"adapter_trimmed": data["filtering_result"]["adapter_trimmed"],
}
metrics = parse_fastp_json("sample_qc.json")
for key, val in metrics.items():
print(f"{key:25s}: {val:.1f}" if isinstance(val, float) else f"{key:25s}: {val:,}")
# Quality gate: fail if < 70% reads pass filter
if metrics["pct_passed"] < 70:
print("WARNING: Low pass rate — check raw data quality")
Step 6: Batch Preprocessing Pipeline
Process multiple samples sequentially with per-sample QC summaries.
#!/bin/bash
# Batch paired-end preprocessing for multiple samples
SAMPLES=(ctrl_1 ctrl_2 treat_1 treat_2)
DATA="data"
OUT="trimmed"
QC="qc/fastp"
THREADS=8
mkdir -p "$OUT" "$QC"
for sample in "${SAMPLES[@]}"; do
echo "=== Processing $sample ==="
fastp \
-i "$DATA/${sample}_R1.fastq.gz" \
-I "$DATA/${sample}_R2.fastq.gz" \
-o "$OUT/${sample}_R1.fastq.gz" \
-O "$OUT/${sample}_R2.fastq.gz" \
-h "$QC/${sample}.html" \
-j "$QC/${sample}.json" \
--thread $THREADS \
--correction \
--detect_adapter_for_pe \
--qualified_quality_phred 20 \
--length_required 36 \
2>&1 | grep -E "Read[12]|Filtering|Adapter|passed"
done
# Aggregate QC metrics
python3 - << 'EOF'
import json, pandas as pd
from pathlib import Path
rows = []
for jf in sorted(Path("qc/fastp").glob("*.json")):
with open(jf) as f: data = json.load(f)
after = data["summary"]["after_filtering"]
before = data["summary"]["before_filtering"]
rows.append({
"sample": jf.stem,
"reads_in": before["total_reads"],
"reads_out": after["total_reads"],
"pct_passed": round(after["total_reads"]/before["total_reads"]*100, 1),
"q30_after": round(after["q30_rate"]*100, 1),
})
df = pd.DataFrame(rows)
print(df.to_string(index=False))
df.to_csv("fastp_summary.tsv", sep="\t", index=False)
EOF
# Run MultiQC to aggregate all fastp JSON reports
mul